View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_68 (Length: 337)
Name: NF15962_low_68
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_68 |
 |  |
|
| [»] scaffold0768 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0768 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: scaffold0768
Description:
Target: scaffold0768; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 215 - 384
Alignment:
| Q |
18 |
aagttatatctaaaggaggaagatttattattgagggaaaaaaggtggtaagatgttgctttgaaaaaggttatacaatgtgtggctatgtgtctatgga |
117 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
215 |
aagttatatataaaggaggaagatatattattgagagaaaaagggtggtaagatgttgctttgaaaaaggttatacaatgtgtggctatgtgtctatgga |
314 |
T |
 |
| Q |
118 |
gtggatgaaaacttattttataggtataatacaatcaattctcagcacttgcagcaaaaggacaaacata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
315 |
gtggatgaaaacttattttataggtataatacaatcaattctcagcacttgcaacaaaaggacaaacata |
384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0768; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 195 - 337
Target Start/End: Original strand, 460 - 602
Alignment:
| Q |
195 |
tgaactttctttatttcgattttattttttgtgttgcaatagatacaatgaaaatgaataaaacaaaagtattatannnnnnnnnataaagcacataaaa |
294 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
460 |
tgaactttctttatttcgaattttttttgtgtgttgcaatagatacaatgaaaatgaatgaaacaaaagtattataattttttttataaagcacacaaaa |
559 |
T |
 |
| Q |
295 |
cgatgtttttgtcacatttaaacaaattttgtcattggatttc |
337 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
560 |
caatgtttttgtcacattttaacaaattttgtcattggatttc |
602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 6845873 - 6845795
Alignment:
| Q |
17 |
aaagttatatctaaaggaggaagatttattattgag-ggaaaaaaggtggtaagatgttgcttt-gaaaaaggttatac |
93 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| | |||||| |||||||| ||||| ||| ||| |||||||||| |
|
|
| T |
6845873 |
aaagctatatataaaggaggaagatttattattgagagaaaaaaatgtggtaaggtgttggtttggaagaaggttatac |
6845795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University