View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15962_low_70 (Length: 334)

Name: NF15962_low_70
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15962_low_70
NF15962_low_70
[»] chr3 (1 HSPs)
chr3 (74-199)||(40352190-40352315)


Alignment Details
Target: chr3 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 74 - 199
Target Start/End: Complemental strand, 40352315 - 40352190
Alignment:
74 ctcacataaaagcaggtaggtttgtggaccaataattgaataaactgatattggtattgggtaataatgagcttttaccttttcaacagttacccgcttt 173  Q
    |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| || ||||    
40352315 ctcacatagaagcaggtaggtttgtggaacaataattgaataaactgatattggtattggataataatgagtttttaccttttcaatagttatccacttt 40352216  T
174 taactttgtagtgaagagatatcagc 199  Q
    | ||||||||||||||||||||||||    
40352215 tgactttgtagtgaagagatatcagc 40352190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University