View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_70 (Length: 334)
Name: NF15962_low_70
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 74 - 199
Target Start/End: Complemental strand, 40352315 - 40352190
Alignment:
| Q |
74 |
ctcacataaaagcaggtaggtttgtggaccaataattgaataaactgatattggtattgggtaataatgagcttttaccttttcaacagttacccgcttt |
173 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| || |||| |
|
|
| T |
40352315 |
ctcacatagaagcaggtaggtttgtggaacaataattgaataaactgatattggtattggataataatgagtttttaccttttcaatagttatccacttt |
40352216 |
T |
 |
| Q |
174 |
taactttgtagtgaagagatatcagc |
199 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
40352215 |
tgactttgtagtgaagagatatcagc |
40352190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University