View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_74 (Length: 330)
Name: NF15962_low_74
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 317
Target Start/End: Complemental strand, 7630760 - 7630459
Alignment:
| Q |
16 |
tgattcactgcaaagtgcattgctgattctcctatcaacctccaagcttgatggacagttaagaaatctatcaaggggaagctcagaaatctctttttcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7630760 |
tgattcactgcaaagtgcattgctgattctcctatcaacctccaagcttgatggacagttaagaaatctatcaaggggaagctcagaaatctctttttcg |
7630661 |
T |
 |
| Q |
116 |
acgtttggttttcgtcgtaagagtcttgttaactccttttgtagttttccaatttcttctggagtgaagtctggtacttcctctgaggaggattgatcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7630660 |
acgtttggttttcgtcgtaagagtcttgttaactccttttgtagttttccaatttcttctggagtgaagtctggtacttcctctgaggaggatggatcct |
7630561 |
T |
 |
| Q |
216 |
cttgttgtgtattttggttttctatgttttgtgtgatttcattgttgtttccaaatgttccaattgctagcaaactatgaggccaatcactaaattcttc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7630560 |
cttgttgtgtattttggttttctatgttttgtgtgatttcgttgttgtttccaaatgttccaattgctagcaaactatgaggccaatcactaaattcttc |
7630461 |
T |
 |
| Q |
316 |
tc |
317 |
Q |
| |
|
|| |
|
|
| T |
7630460 |
tc |
7630459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University