View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15963_low_5 (Length: 239)
Name: NF15963_low_5
Description: NF15963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15963_low_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 52 - 239
Target Start/End: Complemental strand, 5906211 - 5906024
Alignment:
| Q |
52 |
tcattgcttaaactttgtgatagtgatactatttgaggcttattatcctaaatagtatccaaactgccgaagaaacatgattatcttggtcataaagtac |
151 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5906211 |
tcattgcttaaactttgcgatagtgatactatttgaggcttattatcctaaatagtatccaaactgccgaagaaacatgattatcttggtcataaagtac |
5906112 |
T |
|
| Q |
152 |
aggatcttcattgagctccatttacataagtaatgagaactgtccaaaattcacgagtcacggaaagacataattacgaatcagcctc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
5906111 |
tggatcttcattgagctccatttacataagtaatgagaactgtccaaaattcaagagtcacagaaagacataattacgaatcagcctc |
5906024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University