View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15965_low_5 (Length: 259)
Name: NF15965_low_5
Description: NF15965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15965_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 31201105 - 31201347
Alignment:
| Q |
1 |
tctcataccatcttcagtcttttctttaacactctctttcaaatcatttgcagcattgcctctataatataagctcacttttctagctaaacgctttggt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31201105 |
tctcataccatcttccgtcttttctttaacactctctttcaaatcatttgcagcattgcctctataatataagctcacttttctagctaaacgctttggt |
31201204 |
T |
 |
| Q |
101 |
gtagggtcgtacactactttccttaacttgctcaataaagtcgatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31201205 |
gtagggtcgtacactactttccttaacttgcttaataaagtcgatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttg |
31201304 |
T |
 |
| Q |
201 |
accttgaaggtgaatgctggaacatctctctgattcttgtggg |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31201305 |
accttgaaggtgaatgctggaaaatctctctgattcttgtggg |
31201347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 143 - 222
Target Start/End: Original strand, 13605376 - 13605455
Alignment:
| Q |
143 |
gatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttgaccttgaaggtgaatgctggaa |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13605376 |
gatttggaattttctaccaattgtggaacttgtgtgtttgtttgctgtgttgatgttgaccttgaagatgaatgctggaa |
13605455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University