View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15967_high_4 (Length: 453)
Name: NF15967_high_4
Description: NF15967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15967_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 405; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 13 - 437
Target Start/End: Original strand, 4337875 - 4338299
Alignment:
| Q |
13 |
aatatccatacgcatgtccccaaaattattctctccatcaacaaaaaccctttttcccattcatacaaacaaatcaatcaccatcaccaataacagcaac |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4337875 |
aatatccatacgcatgtccccaaaactattctctccatcaacaaaaaccctttttcccattcatacaaacaaatcaatcaccatcaccaacaacagcaac |
4337974 |
T |
|
| Q |
113 |
agaacaaagctatcgttgctctgtttaagttcaagaaacggaacagagtgtcctgttccgttagaacagcagcccataaacgagtaccagtcgttatcga |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337975 |
agaacaaagctatcgttgctctatttaagttcaagaaacggaacagagtgtcctgttccgttagaacagcagcccataaacgagtaccagtcgttatcga |
4338074 |
T |
|
| Q |
213 |
cctcgttcccgttttcatgggctgctggtgatgttgttgaatatggttcccggcttttcgtggtgggcttttcctttgccttgcttgtgggtttacctgt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4338075 |
cctcgttcccgttttcatgggctgctggtgatgttgttgaatatggttcccggcttttcgtggtgggcttttcctttgccttgcttgtggggttacctgt |
4338174 |
T |
|
| Q |
313 |
ggcttggtttggaactgttggggcacaatctgagcctgctaagaggattgtttgtgctgcttctagtggtgttctggctgttacttttgcggttgttagg |
412 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338175 |
ggcttggtttggaactgttggggcacaatatgagcctgctaagaggattgtttgtgctgcttctagtggtgttctggctgttacttttgcggttgttagg |
4338274 |
T |
|
| Q |
413 |
atgtatcttggttgggcttatgttg |
437 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4338275 |
atgtatcttggttgggcttatgttg |
4338299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 4321695 - 4321744
Alignment:
| Q |
142 |
ttcaagaaacggaacagagtgtcctgttccgttagaacagcagcccataa |
191 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
4321695 |
ttcaagaaacggagcagtgtgtcctgttccgcaagaacagcaacccataa |
4321744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University