View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15967_high_8 (Length: 305)
Name: NF15967_high_8
Description: NF15967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15967_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 32268604 - 32268334
Alignment:
| Q |
18 |
tatgcctcttacccaccatcacaagatcatagttttcattacctaaacctcgaagtgcttctaacaactgtgtatagccctccaccacaatttcatgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268604 |
tatgcctcttacccaccatcacaagatcatagttttcattacctaaacctcgaagtgcttctaacaactgtgtatagccctccaccacaatttcatgaca |
32268505 |
T |
 |
| Q |
118 |
aacaacattatcaatatttaatttcttacccttaaactcatctatcaaactctcatccaacatattctctaatgtttcatcttcttcttcaccatcatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268504 |
aacaacattatcaatatttaatttcttacccttaaactcatctatcaaactctcatccaacatattctctaatgtttcatcttcttcttcaccatcatca |
32268405 |
T |
 |
| Q |
218 |
attttaaatttaacatcacctgaattattaatattgttttcattgttatgaacgatgaaacaaaataatgt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268404 |
attttaaatttaacatcacctgaattattaatattgttttcattgttatgaacgatgaaacaaaataatgt |
32268334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University