View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15967_low_8 (Length: 399)
Name: NF15967_low_8
Description: NF15967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15967_low_8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 231 - 399
Target Start/End: Complemental strand, 11524171 - 11524003
Alignment:
| Q |
231 |
tcaaaatctaaaccataaaaacttaccaaagatcttttagcaatatcgaactcaagaatggctgatacaactctagaacagacctggcaatgggggtgca |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11524171 |
tcaaaatctaaaccataaaaacttaccaaagatcttttagcaatatcgaactcaagaatagctgatgcaactctagaacagacctggcaatgggggtgca |
11524072 |
T |
 |
| Q |
331 |
aacgactttacaaagatgggcctcnnnnnnntcattggggtctcaaattgtttattaaaggcatatctt |
399 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11524071 |
aacgactttacaaagttgggcctcaaaaaaatcattggggtctcaaattgtttattacaggcatatctt |
11524003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University