View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15968_low_11 (Length: 337)
Name: NF15968_low_11
Description: NF15968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15968_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 12305435 - 12305616
Alignment:
| Q |
17 |
cagttttctgattatatatatatcttgaaatgcaacatttagtttcaccaaaccatactgtatttttctcca----------tcttttacaaaactcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
12305435 |
cagttttctgattatatatatatcttgaaatgcaacatttagtttcaccaaaccatactgtatttttctccaactttcaccatcttttacaaaactttat |
12305534 |
T |
 |
| Q |
107 |
atctccctttttccattcatttatagaatttgattcactatgagtctatgatgcattaccttcatgttcatttaccaagcca |
188 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12305535 |
atctccctttttcctttcatttatagaatttgattcactatgagtctatgatgcattaccttcatgttcatttaccaagcca |
12305616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 323
Target Start/End: Original strand, 12305692 - 12305750
Alignment:
| Q |
264 |
ttttcagtttcaaccctccaattttctttgtccccctattttttcctggttaagaataat |
323 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||||| ||||||| |||| |||||||| |
|
|
| T |
12305692 |
ttttcagtttcaaccctccgattttctttat-cccctagtttttcccggttgagaataat |
12305750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University