View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15968_low_13 (Length: 330)
Name: NF15968_low_13
Description: NF15968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15968_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 4686373 - 4686687
Alignment:
| Q |
1 |
aatgttgtcatacacaaaccaacaaggcttcaatgatcaagattctattagaaaacttcttatgaagcttggaggaagattttcaggtgattatcatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686373 |
aatgttgtcatacacaaaccaacaaggcttcaatgatcaagattctattagaaaacttcttatgaagcttggaggaagattttcaggtgattatcatcct |
4686472 |
T |
 |
| Q |
101 |
aatactacttttgatgctttgaatcttcaattttcaaatgctacttcttcaactcatgaacaagtttatgatcaagaacatcatgtgggatcttctactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686473 |
aatactacttttgatgctttgaatcttcaattttcaaatgctacttcttcaactcatgaacaagtttatgatcaagaacatcatgtgggatcttctactt |
4686572 |
T |
 |
| Q |
201 |
gtgttaattcttccaatgataacaaccataaccaagtacaatttgcaataaatggtcaatactttgactcggtgcaagaagaacaaggcaagttcattcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686573 |
gtgttaattcttccaatgataacaaccataaccaagtacaatttgcaataaatggtcaatactttgactcggtgcaagaagaacaaggcaagttcattcc |
4686672 |
T |
 |
| Q |
301 |
ggaaattgatcatat |
315 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4686673 |
agaaattgatcatat |
4686687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 47846366 - 47846314
Alignment:
| Q |
29 |
ttcaatgatcaagattctattagaaaacttcttatgaagcttggaggaagatt |
81 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| || |||||||| || ||||| |
|
|
| T |
47846366 |
ttcaacgatcaagattctattagaaaatttctaatcaagcttggtgggagatt |
47846314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University