View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15968_low_17 (Length: 248)
Name: NF15968_low_17
Description: NF15968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15968_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 35857148 - 35857379
Alignment:
| Q |
1 |
catatacttttatgtatttctatcaaaaagtagcgtgttacagtagcagcaaatcagtaatgatttattttttcgtgtgctaattacggcaatgattgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35857148 |
catatacttttatgtatttctatcaaaaagtagcgtgttacagtagcagcaaatcagtaatgatttattttttcgtgtgctaattacggcaatgattgaa |
35857247 |
T |
|
| Q |
101 |
gaacgttcaagacaatgtttttatataccagacaaatggaaagctctgtttgaaattaacattgcgtttaattttgttggcgaaatgctccacagacaac |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35857248 |
gaacgttcaagataatgtttttatatacctaacaaatggaaagctcagtttgaaattaacattgcgtttaattttgttggcgaaatgctccacacacaag |
35857347 |
T |
|
| Q |
201 |
gtgtcccataacaattcttttactgtaataag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35857348 |
gtgtcccataacaattcttttactgtaataag |
35857379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University