View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15969_low_9 (Length: 274)
Name: NF15969_low_9
Description: NF15969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15969_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 130 - 266
Target Start/End: Complemental strand, 27495934 - 27495798
Alignment:
| Q |
130 |
cttgtatgatgaagaaatctttgattatattagtgttttgtgtgagaaagtgagtgagtgatatagaagctaaagaaaacggccacctttgtctgatgag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27495934 |
cttgtatgatgaagaaatctttgattattttagtgttttgtgtgagaaagtgagtgagtgatatagaagctaaagaaaacggccacctttgtctgatgag |
27495835 |
T |
 |
| Q |
230 |
tgcacaaacacaacataacaacgtatatattcatttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27495834 |
tgcacaaacacaacataacaacgtatatattcttttc |
27495798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 27496048 - 27496011
Alignment:
| Q |
16 |
gtttctatgtatatatctaagtatgtatgtatatatgc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27496048 |
gtttctatgtatatatctaagtatgtatgtatatatgc |
27496011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University