View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_101 (Length: 246)
Name: NF1596_high_101
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_101 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25968779 - 25969021
Alignment:
| Q |
1 |
tcggcgtcatcgcacaaggtgagactagggaagctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggcgtaaacggggcaga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25968779 |
tcggcgtcatcgcacaaggtgagaccagggaagctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggtgtaaacggggcaga |
25968878 |
T |
|
| Q |
101 |
gatacttttggtgtcggtaaacctcctcttagagtaattaaactggcgaaaatttcttgtgaatcggttgatcttcaatgaatctttccgattttcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25968879 |
gatacttttggtgtcggtaaacctcctcttagagtagttaaactggcgaaaatttcttgtgaatcggttggtcttcaatgaatctttccgattttcaaat |
25968978 |
T |
|
| Q |
201 |
gtgtctgcattgttgttgcgtctcttgggtatgtctctgctcc |
243 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25968979 |
gtatctgcattgttgttgcgtctcttgggtatgtttctgctcc |
25969021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University