View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_102 (Length: 246)
Name: NF1596_high_102
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 4712228 - 4712022
Alignment:
| Q |
22 |
ggttaattataaattcatgaatgactcggttgtgtttatatcgtttgcatgtaattttagatagcttatcataaggagtagtaaatgaaaggtgaagtta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712228 |
ggttaattataaattcatgaatgactcggttgtgtttatatcgtttgcatgtaattttagatagcttatcataaggagtagtaaatgaaaggtgaagtta |
4712129 |
T |
 |
| Q |
122 |
ctttttgtgttgtgttgttgcaactttttcaagcttatcagttttatgtataaaaggaaaaaccaaagttttggaacgttttccatttggcatacataat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712128 |
ctttttgtgttgtgttgttgcaactttttcaagcttatcagttttatgtataaaaggaaaaaccaaagttttggaacgttttccatttggcatacataat |
4712029 |
T |
 |
| Q |
222 |
tcaaagt |
228 |
Q |
| |
|
||||||| |
|
|
| T |
4712028 |
tcaaagt |
4712022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University