View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_113 (Length: 237)
Name: NF1596_high_113
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_113 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 50411224 - 50411031
Alignment:
| Q |
20 |
aacgacgataccgagagcgaagatggtttgaatattgttttgaacgacgatgattgtcccattccttgtgtcgaggatgttgttcatcgtgaaggtttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50411224 |
aacgacgataccgagagcgaagatggtttgaatattgttttgaacgacgatgattgtcccattccttgtgtcgaggatgttgttcatcgtgaaggtttgg |
50411125 |
T |
 |
| Q |
120 |
aaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattgtggtcagagtagtaaaatctgtgtcagaggcgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50411124 |
aaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattgtggtcagagtagtaaaatctgcgtcagaggcgg |
50411031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University