View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1596_high_113 (Length: 237)

Name: NF1596_high_113
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1596_high_113
NF1596_high_113
[»] chr4 (1 HSPs)
chr4 (20-213)||(50411031-50411224)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 50411224 - 50411031
Alignment:
20 aacgacgataccgagagcgaagatggtttgaatattgttttgaacgacgatgattgtcccattccttgtgtcgaggatgttgttcatcgtgaaggtttgg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50411224 aacgacgataccgagagcgaagatggtttgaatattgttttgaacgacgatgattgtcccattccttgtgtcgaggatgttgttcatcgtgaaggtttgg 50411125  T
120 aaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattgtggtcagagtagtaaaatctgtgtcagaggcgg 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
50411124 aaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattgtggtcagagtagtaaaatctgcgtcagaggcgg 50411031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University