View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_114 (Length: 237)
Name: NF1596_high_114
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_114 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 25256887 - 25257083
Alignment:
| Q |
1 |
taatcttattaatttatgatgtgtttttcacaatcataaatgtaaaatgaaatacaatattttgtgagtgatatacataatatttatttaaagatgcaaa |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||| | |||| ||||||||||||| ||||||||| |||||||||| ||||||| | |||| |||| |||||| ||| |
|
|
| T |
25256887 |
taatcttattaatttattatgtgctttccccaattataaatgtaaaataaaatacaatgttttgtgagtaatatacaaagtattaatttgaagatgtaaa |
25256986 |
T |
 |
| Q |
101 |
atgaacaaatagttaattatacatgaaaaattgaaaatcacattcattttaatacaaatattctttgccaaaataacacttgttgtattagcaataa |
197 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
25256987 |
atgaacaaatagttaattacacattaaaaattgaaaatcacattcattttaatacaaatattcttggtcaaaaaaacacttgttgtattagcaataa |
25257083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University