View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_118 (Length: 231)
Name: NF1596_high_118
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_118 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 3 - 218
Target Start/End: Complemental strand, 34005252 - 34005037
Alignment:
| Q |
3 |
ttagtaaaataagaagtgattattgttatttttgttgtttggtgttagtttctagttttcaactactttaatggtgcctccttttcatttatttaggaga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34005252 |
ttagtaaaataagaagtgattattgttatttttgttgtttggtgttagtttctagttttcaactactttaatggtgcctccttttcatttatttaggaga |
34005153 |
T |
|
| Q |
103 |
tgttttccattgggactctttacatgtgctagttactattgctcctctttgaagcacttccaataaaagtttgtgatggggttttatgacttgtttttgc |
202 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34005152 |
tgttttccattgggattctttacatgtgctagttactattgctcctctttgaagcacttccaataaaagtttgtgatggggttttatgacttggttttgc |
34005053 |
T |
|
| Q |
203 |
tgttctgttatgtttg |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34005052 |
tgttctgttatgtttg |
34005037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University