View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_129 (Length: 203)
Name: NF1596_high_129
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_129 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 19074837 - 19074668
Alignment:
| Q |
16 |
aatactggatgaatgcacttctaagtgacaccatagctatttgggatcaactgaataggaaattcctagattgtttcgttccgacacaaaattacttaga |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19074837 |
aatactggataaatgcacttctaagtgacaacatagctatttgggatcaactgaataggaaattcctagattgtttcgttccgacacaaaattatttaga |
19074738 |
T |
 |
| Q |
116 |
gaggaagcaagggatttctggtttcaaatagcaagatgaaaaacattttatgatccttgagaaaggttcaaact |
189 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
19074737 |
gaggaagcaagagatttctggtttcaaatagcaagatgaaagac----tatgatccttgagaaaggttcaaact |
19074668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 25 - 92
Target Start/End: Original strand, 27583180 - 27583247
Alignment:
| Q |
25 |
tgaatgcacttctaagtgacaccatagctatttgggatcaactgaataggaaattcctagattgtttc |
92 |
Q |
| |
|
|||||||||||| |||||||||||| | || ||||||| |||| || ||| ||||||| ||||||||| |
|
|
| T |
27583180 |
tgaatgcacttccaagtgacaccatcgttacttgggatgaactaaagaggcaattccttgattgtttc |
27583247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University