View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_37 (Length: 396)
Name: NF1596_high_37
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 17 - 389
Target Start/End: Original strand, 43695713 - 43696081
Alignment:
| Q |
17 |
aatgatcacaaaaaacgtaagctttttggttcaagagcagtggtagtgctcctttcttggtcttgtatatttaggattaggacaacatgtgatgccgcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695713 |
aatgatcacaaaaaacgtaagctttttggtttaagagcagtggtagtgctcctttcttggtcttgtatatttaggattaggacaacatgtgatgccgcca |
43695812 |
T |
 |
| Q |
117 |
ttagtaatgacaacctatcatagtagtaactaaagtatggtttgaatgtagatggttttcacctgatctggttcaatacaagtagaaatattgtagcaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
43695813 |
ttagtaatgacaacctatcatagtagtaactaaagtatggtttgaatctaggt-gttttcacctgatctggttcaatacaagtagaaa---tttagcaaa |
43695908 |
T |
 |
| Q |
217 |
taaatggagctataatttaattttttactttctttccctccacnnnnnnnncttctctaaaccaaacatggtggtagtgattgcacacaacacaaatcca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43695909 |
taaatggagctataatttaattttttactttctttccctccacttttttttcttctctaaaccaaacatggtggtagtgattgcacacagcacaaatcca |
43696008 |
T |
 |
| Q |
317 |
aataaaagcatatgaatcagtgaaacaccatggcatcactatttatttttatcgccgcataagaaaagttcat |
389 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43696009 |
aataaaagcacatgaatcagtgaaacaccatggcatcactatttatttttatcgccgcataagaaaagctcat |
43696081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University