View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_75 (Length: 284)
Name: NF1596_high_75
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 13 - 269
Target Start/End: Complemental strand, 43482881 - 43482625
Alignment:
| Q |
13 |
tgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgcggggccatatgtcaggtctgtaaccagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482881 |
tgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgcggggccatatgtcaggtctgtaaccagt |
43482782 |
T |
 |
| Q |
113 |
ttaccctgccatcacttcttagctacctcatccacttgtcaatgtctaccttttcacctggaaatatataaaacatttgtagtttgatttgtttaacttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43482781 |
ttaccctgccatcacttcttagctacctcatccacttgtcaatgtctaccttttcacctggaaatatataaaacatttgtagtttgatttgtttaagttt |
43482682 |
T |
 |
| Q |
213 |
gggttgagggtgaatttggcgaaaattgcaatgccaccatgatttcgttgaagttct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482681 |
gggttgagggtgaatttggcgaaaattgcaatgccaccatgatttcgttgaagttct |
43482625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University