View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_78 (Length: 271)
Name: NF1596_high_78
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 264
Target Start/End: Complemental strand, 36814736 - 36814475
Alignment:
| Q |
3 |
tatttaagttttttagtgatgaggaccaattgacttactagtaaaagccactgttaatccatattatgnnnnnnnnnaagctgaaatctggaactgcatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36814736 |
tatttaagttttttagtgatgaggaccaattgacttactagtaaaagccactattaatccatattatgtttctttttaagctgaaatctggaacagcatt |
36814637 |
T |
|
| Q |
103 |
aacggcttgttgtacagttgtgaaattacaacacccttttcgatcgacacaaaggtaggaagtggtattggtgtttggaggtggaattccaggtggaaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814636 |
aacggcttgttgtacagttgtgaaattacaacacccttttcgatcaacacaaaggtaggaagtggtattggtgtttggaggtggaattccaggtggaaaa |
36814537 |
T |
|
| Q |
203 |
tcatcacaaatagaaccatcactcccactgtcagggtgttttttgtgtggtctatgatgatg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814536 |
tcatcacaaatagaaccatcactcccactgtcagggtgttttttgtgtggtctatgatgatg |
36814475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University