View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_high_94 (Length: 249)
Name: NF1596_high_94
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_high_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 51729392 - 51729154
Alignment:
| Q |
1 |
ctgagaaatctcagttgaagaaaattgaatatgcacaaactaaagaaaaagagagaaagattaca--caatagtgtcaaaagtaatcaaagaagaattcc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51729392 |
ctgagaaatctcagttgaagaaaattgaatatccacaaactaaagaaaaagagagaaagattacagacaatagtgtcaaaagtaatcaaagaagaattcc |
51729293 |
T |
 |
| Q |
99 |
acatttccatacatagatatgaaacatactttggaagcacgnnnnnnntcctgatttacagcataactctcatttctttttcgacaactttgggcctcaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729292 |
acatttccatacatagatatgaaacatactttggaagcacgaaaaaaatcctgatttacagcataactctcatttctttttcgacaactttgggcctcaa |
51729193 |
T |
 |
| Q |
199 |
gtttcaactttcaccacccagtgagcatacctaggttca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729192 |
gtttcaactttcaccacccagtgagcatacctaggttca |
51729154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University