View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_108 (Length: 242)
Name: NF1596_low_108
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 38 - 224
Target Start/End: Original strand, 38892784 - 38892965
Alignment:
| Q |
38 |
gtgaacctatgttctttagttttaagttttgactgcggcactcacggcgttaaaattttgtttgtgttcttttggttacatgagatgagagcgtggtggt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38892784 |
gtgaacctatgttctttagttttaagttttgactgcggcactcacggcgttaaaattttgtttgtgttcttttggttacatga-----gagcgtggtggt |
38892878 |
T |
 |
| Q |
138 |
gtgggagtgggacaagttatgtagacattgttctaatgattatcaatcacttttttcccaaaaatttggatttttaaagattgcctt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892879 |
gtgggagtgggacaagttatgtagacattgttctaatgattatcaatcacttttttcccaaaaatttggatttttaaagattgcctt |
38892965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University