View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_115 (Length: 238)
Name: NF1596_low_115
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_115 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 38838399 - 38838631
Alignment:
| Q |
18 |
catcggtggtgaggaatttcgacggcaaattcaactgatgttgatgagcatgcaccatattttgatggttcacacgccgcctt-----------ctttag |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| | | |||||| |
|
|
| T |
38838399 |
catcggtggtgaggaatttcgacggaaaattcagctgatgttgatgagcatgcaccatattttgatggttcacacgccttcatgaaaaatatctctttag |
38838498 |
T |
|
| Q |
107 |
ttctttaagttgtttggttagctactatctgaatagtgtagaatgagaggagtgcttaaatcttcaatagtaaattattaactctagagcaacttcttga |
206 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38838499 |
ttctttaggttgtttggttagctactatttgaatagtgtagaatgagaggagtgcttaaatcttcagtagtaaattattaaatctagagcaacttcttga |
38838598 |
T |
|
| Q |
207 |
t-gtttgatggtggataaagacgtataaaccac |
238 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| |
|
|
| T |
38838599 |
tcgtttgatggtggataaggacgtataaaccac |
38838631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University