View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_119 (Length: 236)
Name: NF1596_low_119
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_119 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 25045845 - 25045636
Alignment:
| Q |
10 |
gtatgaaccagaaaatttgacatatagttaacaattaacatgattttctgggttcaataatagcctagcatggatttactaaatttttatcnnnnnnngt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
25045845 |
gtatgaaccagaaaatttgacatatagttaacaattaacatgattttctgggttcaataatagcctagcatgcatttactaaatttttatgtttttttct |
25045746 |
T |
|
| Q |
110 |
tgtatttactcgttacaaagcctctgtcccttctccttcaccctcctttcccaaatcacaactttcctatctcgagatgtaatcacgaccagttctgcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25045745 |
tgtatttactcgttacaaagcctctgtcccttctccttcaccctcctttcccaaatcccaactttcctatctcaatatgtaatcacgaccagttctgctg |
25045646 |
T |
|
| Q |
210 |
tgatgaggtg |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
25045645 |
agatgaggtg |
25045636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 110 - 219
Target Start/End: Complemental strand, 25050236 - 25050127
Alignment:
| Q |
110 |
tgtatttactcgttacaaagcctctgtcccttctccttcaccctcctttcccaaatcacaactttcctatctcgagatgtaatcacgaccagttctgcta |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |||| ||||||||||||| ||||||||| | |
|
|
| T |
25050236 |
tgtatttactctgtacaaagcctctgtcccttctccttcacccttctttcccaaatcccaactttcctctctcaagatgtaatcacggccagttctggtg |
25050137 |
T |
|
| Q |
210 |
tgatgaggtg |
219 |
Q |
| |
|
| |||||||| |
|
|
| T |
25050136 |
taatgaggtg |
25050127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University