View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_123 (Length: 230)
Name: NF1596_low_123
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_123 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 1109863 - 1109646
Alignment:
| Q |
13 |
ttctgtggtgatagagttgaaaggaccggtaacccagtgattgagaaactttcagatttacagaaactatcggaaattatcgtgtccaaatttggtcctt |
112 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1109863 |
ttctgtggtgatcgagttgaaaggaccagtaacccagtgattgagaaactttcagatttacagaaactatctgaaattatcgtgtccaaatttggtcctt |
1109764 |
T |
|
| Q |
113 |
tcataaatgcttgggttattgaagcttctgttttcaatggaccgtttgctgtctataaggactttataccatctgtgaatcaatatggagagccaaggtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109763 |
tcataaatgcttgggttattgaagcttctgttttcaatggaccgtttgctgtctataaggactttataccatctgtgaatcaatatggagagccaaggtc |
1109664 |
T |
|
| Q |
213 |
gtaccatccaactggatt |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1109663 |
gtaccatccaactggatt |
1109646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 130 - 230
Target Start/End: Complemental strand, 1093318 - 1093218
Alignment:
| Q |
130 |
attgaagcttctgttttcaatggaccgtttgctgtctataaggactttataccatctgtgaatcaatatggagagccaaggttgtaccatccaactggat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
1093318 |
attgaagcttctgttttcaatggaccgttagctgtctataaggactttataccatctgtgaatcaatatggagaaccaaggtcataccatgcaactggat |
1093219 |
T |
|
| Q |
230 |
t |
230 |
Q |
| |
|
| |
|
|
| T |
1093218 |
t |
1093218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University