View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1596_low_125 (Length: 224)

Name: NF1596_low_125
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1596_low_125
NF1596_low_125
[»] chr8 (1 HSPs)
chr8 (61-208)||(14452768-14452919)


Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 61 - 208
Target Start/End: Original strand, 14452768 - 14452919
Alignment:
61 atgcatatgaatgctctaacggtaaacagcgccaagtgaagctagaagaaagtttgtttcatctttcttgtcgagaaatcgattggtctcgatgttacat 160  Q
    ||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
14452768 atgcatatgaatgctctaacggtaagcagcaccaagtgaagctagaagagagtttgtttcatctttcttgtcgagaaatcgattggtctcgatgttacat 14452867  T
161 gttgaaacgatggaaggccac----acttccatcggtgtcgaaggcaatatc 208  Q
    |||||||||||||||||||||    |||||||||||||||||||||||||||    
14452868 gttgaaacgatggaaggccacggttacttccatcggtgtcgaaggcaatatc 14452919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University