View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_125 (Length: 224)
Name: NF1596_low_125
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_125 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 61 - 208
Target Start/End: Original strand, 14452768 - 14452919
Alignment:
| Q |
61 |
atgcatatgaatgctctaacggtaaacagcgccaagtgaagctagaagaaagtttgtttcatctttcttgtcgagaaatcgattggtctcgatgttacat |
160 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14452768 |
atgcatatgaatgctctaacggtaagcagcaccaagtgaagctagaagagagtttgtttcatctttcttgtcgagaaatcgattggtctcgatgttacat |
14452867 |
T |
 |
| Q |
161 |
gttgaaacgatggaaggccac----acttccatcggtgtcgaaggcaatatc |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14452868 |
gttgaaacgatggaaggccacggttacttccatcggtgtcgaaggcaatatc |
14452919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University