View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_131 (Length: 204)
Name: NF1596_low_131
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_131 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 16906601 - 16906771
Alignment:
| Q |
19 |
atttaactcaaatggtaaataagctcttatgatgaatcatttaagatgatccaagttcaaattatgaatagaacagttatttgatattaaatgactgaaa |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16906601 |
atttaactcaagtggtaaataagctcttacgatgaatcatttaagaggatccaagttcaaattatgaatagaacaattatttgacattaaatgactgaaa |
16906700 |
T |
|
| Q |
119 |
taaagttgtaaatgaacccctaagataaatcatttgagataatccatgttcgaattctgaatagaataatt |
189 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16906701 |
taaagttgtaaatgaacccctacgataaatcatttgagataatccatgttcgaattctggatagaataatt |
16906771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University