View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_15 (Length: 513)
Name: NF1596_low_15
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 142 - 338
Target Start/End: Complemental strand, 33526082 - 33525886
Alignment:
| Q |
142 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526082 |
tataagagtaattaatattggaaaatgatcagattaattcatcttttccaacttcgactcctcgacattggatctgttaaaccaccaacaatccatgtct |
33525983 |
T |
 |
| Q |
242 |
ctctagcaatgtcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatcaatga |
338 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525982 |
ctctagcaatatcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatcaatga |
33525886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 79
Target Start/End: Complemental strand, 33526211 - 33526145
Alignment:
| Q |
14 |
cagagaaaccaaa-tgatcataaaagattctaaacctggaaatttaatgttgaatttcccagttagc |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33526211 |
cagagaaaccaaaatgatcataaaagattctaaacctgggaatttaatgttgaatttcccagttagc |
33526145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University