View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_48 (Length: 345)
Name: NF1596_low_48
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 47180253 - 47179921
Alignment:
| Q |
1 |
ttgcctttgatcattgatacaaataaatacaataaaatgctcaatgattcaatgcatctcatcaagttttaagggaaccaaatagctagaacctagaaga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180253 |
ttgcttttgatcattgatacaaataaatacaataaaatgctcaatgattcaatgcatctcatcaagttttaagggaaccaaatagctagaacctagaaga |
47180154 |
T |
 |
| Q |
101 |
ataaatttggcgttttttgaatannnnnnnnaggagaaatagaagctaggtaagctcacagagatgaggttttcagggtgaatgactgaagtcatcacag |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180153 |
ataaatttggcgttttttgaatattttttt-aggagaaatagaagctaggtaagctcacagagatgaggttttcagggtgaatgactgaagtcatcacag |
47180055 |
T |
 |
| Q |
201 |
tttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaagtacttgcaccctctttcttttgtcatcatacaaggag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180054 |
tttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaagtacttgcaccctctttcttttgtcatcatacaaggag |
47179955 |
T |
 |
| Q |
301 |
tggatgtgtgtgagtttttggtcattttccctat |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47179954 |
tggatgtgtgtgagtttttggtcattttccctat |
47179921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University