View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_51 (Length: 343)
Name: NF1596_low_51
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 33815515 - 33815326
Alignment:
| Q |
17 |
gttcatttgtgggaactggcacaccagaggaatgaactaacatcacatcttctccaaacactgttttgatgtctagtggccctgcttgaatttctgttgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815515 |
gttcatttgtgggaactggcacaccagaggaatgaactaacatcacatcttctccaaacactgttttgatgtctagtggccctgcttgaatttctgttgc |
33815416 |
T |
 |
| Q |
117 |
aatcccattgataaacactgttgccaatcctgttacagtactagcacctccaaatccttaataataccaaaatattgttagaacttgacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815415 |
aatcccattgataaacactgttgccaatcctgttacagtactagcacctccaaatccttaataataccaaaatattgttagaacttgacc |
33815326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 274 - 337
Target Start/End: Complemental strand, 33815257 - 33815194
Alignment:
| Q |
274 |
gttgatctcattaatgtttcagcaaacactttgaatctcaatttactcctgaatttcatctctc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33815257 |
gttgatctcattaatgtttcagcaaacactttgaatctcaatttactcctgaatttcatatctc |
33815194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University