View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_52 (Length: 337)
Name: NF1596_low_52
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 45386109 - 45385990
Alignment:
| Q |
1 |
aggagtggaatgggtggaagctaatctgaagaactctgagttaagcgtgaagggagtgtatgattcagcaatgttggttgaatatgtgtacaagagaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45386109 |
aggagtggaatgggtggaagctaatctgaagaactctgaggtaagcgtgaagggagtgtatgattcagcaatgttggttgaatacatgtacaagagaatt |
45386010 |
T |
|
| Q |
101 |
gggaagcatgcagtgattgt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45386009 |
gggaagcatgcagtgattgt |
45385990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 45390260 - 45390144
Alignment:
| Q |
1 |
aggagtggaatgggtggaagctaatctgaagaactctgagttaagcgtgaagggagtgtatgattcagcaatgttggttgaatatgtgtacaagagaatt |
100 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||| ||| |||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45390260 |
aggagtggaattggtggaaactgatctgaagaactccgaggtaagtgtgaagggggtgtatgatccagcaatgttggttgaatatgtgtacaagagaatt |
45390161 |
T |
|
| Q |
101 |
gggaagcatgcagtgat |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45390160 |
gggaagcatgcagtgat |
45390144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 212 - 282
Target Start/End: Complemental strand, 45385898 - 45385828
Alignment:
| Q |
212 |
actaagttggaggaggagatgnnnnnnnntgaacactactttaatccaccaatcaatatgtatgcataccc |
282 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45385898 |
actaagttggaggaggagatgaaaaaaaatgaacactactttaatccaccaatcaatatgtatgcataccc |
45385828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University