View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_62 (Length: 311)
Name: NF1596_low_62
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 22061839 - 22061533
Alignment:
| Q |
1 |
ttcatgataagaatagtaatcagttacatctaagggatgatgattttgtcaaagatgttagcaccattttggatataattaa----tagggttcgccgac |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22061839 |
ttcatgataagaatagtaatcagttacatctaagggatgatcattttgtcaaagatgttaacaccattttggatataattaacgaatagggttcgccgac |
22061740 |
T |
|
| Q |
97 |
aatccaacaccgaaatccatcgccggcgagtgaacctttggtattatcgtcagaaacaattggccggatttaggtgttgaagcgaagaaggaaggattat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
22061739 |
aatccaacaccgaaatccatcgccggcgagtgaacctttggtattatcgtcagaaacaattggccggatttaggtgttggagcgaagaaggaaggaatat |
22061640 |
T |
|
| Q |
197 |
cggagtggaggagtaacaggagcatgaattggaggttttgctgataaactgatcagagatggagatcgctggtgaagattgtatttctggggatgatgat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22061639 |
cggagtggaggagtaacaggagcatgaattggaggttttgctgataaactgatcagagatggagatcgctggtgaagattgtatttccggggatgatgat |
22061540 |
T |
|
| Q |
297 |
gatgtcc |
303 |
Q |
| |
|
||||||| |
|
|
| T |
22061539 |
gatgtcc |
22061533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 32904259 - 32904337
Alignment:
| Q |
2 |
tcatgataagaatagtaatcagttacatctaagggatgatgattttgtcaaagatgttagcaccattttggatataatt |
80 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32904259 |
tcatgataagaatagtagtcagttacatttaagggatgatggttttgtcaaagatgttaagaccattttggatataatt |
32904337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University