View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_63 (Length: 311)
Name: NF1596_low_63
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 26298616 - 26298818
Alignment:
| Q |
1 |
cgaatcattgttgtacactgcaactgcgatgatgatgaaataagttagtttttagtaagcaattctcagttcctgctgctgctctgctgtccagcgggtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26298616 |
cgaatcattgttgtacactgcaactgcgatgatgatgaaataatttagtttttagtaagcaattctcagttcctgctgctgctctgctgtccagcgggtc |
26298715 |
T |
|
| Q |
101 |
tcagtttagctgtgtttccatttgttttctattttgagctttagtctatacactgagatccttgtgtgtgcacttgcaagtgtttaataaacttagctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
26298716 |
tcagtttagctgtgtttccatttgttttctattttgagctttagtctatacactgagctccttgtatgtgcacttgcaagtgtttaataaacttagcttt |
26298815 |
T |
|
| Q |
201 |
taa |
203 |
Q |
| |
|
||| |
|
|
| T |
26298816 |
taa |
26298818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 3 - 113
Target Start/End: Original strand, 26278858 - 26278965
Alignment:
| Q |
3 |
aatcattgttgtacactgcaactgcgatgatgatgaaataagttagtttttagtaagcaattctcagttcctgctgctgctctgctgtccagcgggtctc |
102 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
26278858 |
aatcattgttgtgcactgcaactgcaatgatgatgaaataagttagtttttagtaagcaattctcagttc---ctgctgctctgctgtccaacgggtctc |
26278954 |
T |
|
| Q |
103 |
agtttagctgt |
113 |
Q |
| |
|
||||| ||||| |
|
|
| T |
26278955 |
agtttcgctgt |
26278965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University