View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_68 (Length: 306)
Name: NF1596_low_68
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 293
Target Start/End: Complemental strand, 3239054 - 3238779
Alignment:
| Q |
18 |
acaatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctgnnnnnnntatcgaaaacatacaaaaattgagcacatgacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3239054 |
acaatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctgaaaaaaatatcgaaaacatacaaaaattgagcacatgacaa |
3238955 |
T |
 |
| Q |
118 |
tgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaagaaactttctgagtacgtcttagaatcacatttggagaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238954 |
tgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaagaaactttctgagtacgtcttagaatcacatttggagaag |
3238855 |
T |
 |
| Q |
218 |
ttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttactgtttcagtgatgat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238854 |
ttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttactgtttcagtgatgat |
3238779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 258
Target Start/End: Complemental strand, 3243022 - 3242949
Alignment:
| Q |
185 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctgggga |
258 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3243022 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 3243197 - 3243141
Alignment:
| Q |
20 |
aatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctg |
76 |
Q |
| |
|
|||||||||||||| | |||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
3243197 |
aatgacaagtaaccagagttgttctcgttcccttttggattcataacaatccgcctg |
3243141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University