View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_71 (Length: 300)
Name: NF1596_low_71
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 46922448 - 46922164
Alignment:
| Q |
1 |
cttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactagaaaccatcttcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922448 |
cttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactagaaaccatcttcaag |
46922349 |
T |
 |
| Q |
101 |
agctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtcacttcaatatcagcaatattgcgagattgaacctcaccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922348 |
agctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtaacttcaatatcagcaatattgcgagattgaacctcaccac |
46922249 |
T |
 |
| Q |
201 |
ccatttttgtctcagaactctcacacacaccgtcacttgttgagtattgtggaaaggtaaaaaattcagaaaagggcttgttttt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922248 |
ccatttttgtctcagaactctcacacacaccgtcacttgttgagtattgtggaaaggtaaaaaattcagaaaagggcttgttttt |
46922164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 77 - 177
Target Start/End: Original strand, 36675815 - 36675915
Alignment:
| Q |
77 |
tgcaaactagaaaccatcttcaagagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtcacttcaatatcagcaa |
176 |
Q |
| |
|
||||||| ||| || || ||||||||||| ||||| || || ||| ||||||||| |||||||||||| |||| |||||||||||||| || ||||||| |
|
|
| T |
36675815 |
tgcaaaccagatacaattttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaa |
36675914 |
T |
 |
| Q |
177 |
t |
177 |
Q |
| |
|
| |
|
|
| T |
36675915 |
t |
36675915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University