View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1596_low_79 (Length: 282)

Name: NF1596_low_79
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1596_low_79
NF1596_low_79
[»] chr1 (5 HSPs)
chr1 (18-272)||(36531623-36531877)
chr1 (28-255)||(26305544-26305771)
chr1 (18-102)||(20628386-20628470)
chr1 (18-130)||(36552935-36553047)
chr1 (173-239)||(36525330-36525396)


Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 36531877 - 36531623
Alignment:
18 gtttgaagattgtgacttcattggcttggacacaggaataaagccatccttactcttctcatctttatgttgcttaccgactccattagcacatgttttc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36531877 gtttgaagattgtgacttcattggcttggacacaggaataaagccatccttactcttctcatctttatgttgcttaccaactccattagcacatgttttc 36531778  T
118 atacacgaaggatacgacggcacaaaagtgtctgcacatccactaccaacggatgttccaccattacttttacaggctggttttggtggatcctgcgttg 217  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531777 atacatgaaggatacgacggcacaaaagtgtctgcacatccactactaacggatgttccaccattacttttacaggctggttttggtggatcctgcgttg 36531678  T
218 gaacctttttcggggcaccaaactgtacgaatgatgggaaagtctgtggattcat 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531677 gaacctttttcggggcaccaaactgtacgaatgatgggaaagtctgtggattcat 36531623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 28 - 255
Target Start/End: Original strand, 26305544 - 26305771
Alignment:
28 tgtgacttcattggcttggacacaggaataaagccatccttactcttctcatctttatgttgcttaccgactccattagcacatgttttcatacacgaag 127  Q
    ||||||| |||||| |||||||  |||| | |||||| ||||||||| ||||| ||| |||||||||| || |||   ||| | ||||||||||| ||||    
26305544 tgtgactccattggtttggacaggggaacatagccatacttactcttttcatcattaagttgcttaccaaccccagcggcagaggttttcatacatgaag 26305643  T
128 gatacgacggcacaaaagtgtctgcacatccactaccaacggatgttccaccattacttttacaggctggttttggtggatcctgcgttggaaccttttt 227  Q
    |||| ||| |||||||||  |||||| ||| || ||||| || | ||||||||||||||||  |||| | |||||||||| ||||| | ||| | |||||    
26305644 gatatgactgcacaaaagcatctgcatatctaccaccaaggggttttccaccattacttttggaggccgcttttggtggagcctgcatgggagcattttt 26305743  T
228 cggggcaccaaactgtacgaatgatggg 255  Q
    | |||||| |||| |||| |||||||||    
26305744 ccgggcacgaaaccgtacaaatgatggg 26305771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 20628386 - 20628470
Alignment:
18 gtttgaagattgtgacttcattggcttggacacaggaataaagccatccttactcttctcatctttatgttgcttaccgactcca 102  Q
    |||||| | |||||||| |||||| ||||||||||||| | ||||||||||||| || |||||||||||||||||||| ||||||    
20628386 gtttgaggcttgtgactccattggtttggacacaggaacatagccatccttacttttttcatctttatgttgcttaccaactcca 20628470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 130
Target Start/End: Complemental strand, 36553047 - 36552935
Alignment:
18 gtttgaagattgtgacttcattggcttggacacaggaataaagccatccttactcttctcatctttatgttgcttaccgactccattagcacatgttttc 117  Q
    |||||| |||||||||| | ||||  |||||||||||| | |||||||||| ||||  |||||| ||||||||||| | |||||||||| ||||||| ||    
36553047 gtttgaggattgtgactccgttggtctggacacaggaacatagccatccttgctctcttcatctatatgttgcttagcaactccattaggacatgttctc 36552948  T
118 atacacgaaggat 130  Q
    ||| | |||||||    
36552947 atatatgaaggat 36552935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 239
Target Start/End: Complemental strand, 36525396 - 36525330
Alignment:
173 ttccaccattacttttacaggctggttttggtggatcctgcgttggaacctttttcggggcaccaaa 239  Q
    |||||| |||||||||| ||||| ||||||| ||| ||||| || || |||||||||||||||||||    
36525396 ttccacgattacttttagaggctagttttggcggagcctgcattcgagcctttttcggggcaccaaa 36525330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University