View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_83 (Length: 264)
Name: NF1596_low_83
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 108 - 228
Target Start/End: Original strand, 47180353 - 47180473
Alignment:
| Q |
108 |
acactcatggattcaccaaaaatacaccacagcagactaaaaacttcagttactctgattctcataatttttcttaccttatttgcttctaatttaggta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180353 |
acactcatggattcaccaaaaatacaccacagcagactaaaaacttcagttactctgattctcataatttttcttaccttatttgcttctaatttaggta |
47180452 |
T |
|
| Q |
208 |
cacatatcaatgttcatatac |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47180453 |
cacatatcaatgttcatatac |
47180473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 47180245 - 47180289
Alignment:
| Q |
1 |
caaaggcaaacctctcgtcttccctactactattgcatatagcca |
45 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47180245 |
caaaagcaaacctctcgtcatccctactactattgcatatagcca |
47180289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University