View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_86 (Length: 260)
Name: NF1596_low_86
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 25256771 - 25256547
Alignment:
| Q |
9 |
caactttacgatataaatttatgaatttttaatgattattgatattttgtttatcaataacaaaattaatcgatgcttatttcaagatggaaaaattata |
108 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25256771 |
caactttacgata--aatttatgaattttcaataattattgatattttgtttatcagtaacaaaattaatcgatgcttattttaaaatggaaaaattata |
25256674 |
T |
 |
| Q |
109 |
agccatgaataattgttgtttatttagagaaaacaaaactatcattaatcaactttttaaaaatatttnnnnnnnnnccagcgagacccatagtctcatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
25256673 |
agccatgaataattgttgtttatttagagaaaacaaaactatcattaatcaactttttaaaaatattt-taaaaaaaccagcgagacccatcgtctcatc |
25256575 |
T |
 |
| Q |
209 |
tttctacgcggaaactctctcgctctct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25256574 |
tttctacgcggaaactctctcgctctct |
25256547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University