View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_91 (Length: 251)
Name: NF1596_low_91
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_91 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 4490893 - 4490655
Alignment:
| Q |
1 |
tatacagatgcagggtctgtggatagcaaaagtctcacttgatacaagtttaagatgctaaacataaggctaatatttagatcagaaattcagtatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4490893 |
tatacagatgcagggtctgtggatagcaaaagtctcacttgatacaagtttaagatgctaaacataaggctaatatttagatcagaaattcagtatgcat |
4490794 |
T |
|
| Q |
101 |
ccatagaacgtattatttacttacaaacttaaatacgaatgagatggctttatggaattggccaacattaattgtgaagattgtattttttggacacatg |
200 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
4490793 |
ccatagaacgtattatatatttacaaacttatatacgaatgagatggctttatggaattggccaacattaattgtgaatattgtattttgtggacacatg |
4490694 |
T |
|
| Q |
201 |
taaaagcctaaaagtccttaagtttggggtccacttctc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4490693 |
taaaagcctaaaagtccttaagtttggggtccacttctc |
4490655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 4496425 - 4496341
Alignment:
| Q |
86 |
aaattcagtatgcatccatagaacgtattatttacttacaaacttaaatacgaatgagatggctttatggaattggccaacatta |
170 |
Q |
| |
|
|||||||| |||||||| | ||| ||| | | |||||||||||||| ||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
4496425 |
aaattcagaatgcatccctggaatgtactgtatacttacaaacttatatatgaatgagatggctttaaggaattggccaacatta |
4496341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 4496506 - 4496457
Alignment:
| Q |
30 |
aagtctcacttgatacaagtttaagatgctaaacataaggctaatattta |
79 |
Q |
| |
|
|||| |||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4496506 |
aagtttcacttaatacaagtaaaagatgctaaacataaggctaatattta |
4496457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University