View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1596_low_96 (Length: 249)
Name: NF1596_low_96
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1596_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 38838731 - 38838973
Alignment:
| Q |
2 |
tatatacttttttattcctcataggatctccttgtgcttattagggaggttttaatctattttgcttttgacctgatnnnnnnnnnnnnnnnnnnnnnnn |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838731 |
tatatacttttttattactcataggatctccttgtgcttattagggaggttttaatctattttgcttttgacctgataaaaaaaaaataaaagatacaaa |
38838830 |
T |
 |
| Q |
102 |
nntatgctttatgtaatgttttattctccaaccgttacctcaatattattaccaaagtaagtaaatgcttcttgcttctttctttggtacttctttta-- |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838831 |
aatatgctttatgtaatgttttattctccaaccgttacctcaa---tattacca----aagtaaatgcttcttgcttctttctttggtacttcttttatt |
38838923 |
T |
 |
| Q |
200 |
----------ataaagcttgtagtagtacttcttatattttacctttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838924 |
ttatttttttataaagcttgtagtagtacttcttatattttacctttcat |
38838973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University