View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15970_high_12 (Length: 242)
Name: NF15970_high_12
Description: NF15970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15970_high_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 964802 - 964737
Alignment:
| Q |
177 |
cttatctgtcttgaaattgttgtagaattgtccaccaacatagctcaacaaatacctctaaacatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
964802 |
cttatctgtcttgaaattgttgtagaattgtccaccgacatagctcaatcaacacctctaaacatc |
964737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 242
Target Start/End: Complemental strand, 36050356 - 36050297
Alignment:
| Q |
183 |
tgtcttgaaattgttgtagaattgtccaccaacatagctcaacaaatacctctaaacatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
36050356 |
tgtcttgaaattgttgtagaattgtccaccgacatagctcaatcaacacctctaaacatc |
36050297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 5695976 - 5696041
Alignment:
| Q |
177 |
cttatctgtcttgaaattgttgtagaattgtccaccaacatagctcaacaaatacctctaaacatc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| |||||| |||| || ||||||||||||| |
|
|
| T |
5695976 |
cttatctgtcttgaaattgttgtagaaatgaccaccgacatagttcaatcaacacctctaaacatc |
5696041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 92
Target Start/End: Original strand, 5695837 - 5695894
Alignment:
| Q |
34 |
atctgagaattcgggaacaaacgtaatttagtaaaaatccttaagaatgttgtagaatt |
92 |
Q |
| |
|
||||||||||| |||||||| | |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
5695837 |
atctgagaattagggaacaa-cataatttagagaaaatccttaagaatgttgtaaaatt |
5695894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University