View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15970_high_8 (Length: 299)
Name: NF15970_high_8
Description: NF15970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15970_high_8 |
 | |
|
| [»] scaffold0102 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0102 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 5 - 281
Target Start/End: Original strand, 34525 - 34801
Alignment:
| Q |
5 |
gactttaagacgttagcaatgacagctgaaagcagcatgttgatccaacacaagataccaggaaagatgaaggacccatttagcttcactattccatgtt |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34525 |
gactttaagacattagcaatgacagctgaaagcagcatgttgatccaacacaagataccaggaaagatgaaggacccatgtagcttcactattccatgtt |
34624 |
T |
|
| Q |
105 |
ctataggtggagtttattgtggggaggcactttgtgatttaggggaaagcatcaatttgatgcctaaatcaattatcaatcaattgggaattggtcaagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34625 |
ctataggtggagtttattgtggggaggcactttgtgatttaggggcaagcatcaatttgatgcctaaatcaattatcaatcaattgggaattggtcaagc |
34724 |
T |
|
| Q |
205 |
caaggcgactgctgtgaatctacaactggctgctaggtgtctagttcacccggaaggaaggacaggtgatgtacttg |
281 |
Q |
| |
|
|||| | |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
34725 |
caagcctactgctgtgaatttacaactggctgctaggtgtctagttcaccctgaaggaaggacaagtgatgtacttg |
34801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 85 - 254
Target Start/End: Original strand, 13840684 - 13840853
Alignment:
| Q |
85 |
tagcttcactattccatgttctataggtggagtttattgtggggaggcactttgtgatttaggggaaagcatcaatttgatgcctaaatcaattatcaat |
184 |
Q |
| |
|
||||||||| ||||| | || ||||| || ||||||||||||| |||| ||||||||||| || | |||||||||| | |||||||||| |||| ||||| |
|
|
| T |
13840684 |
tagcttcaccattccttattttatagatgaagtttattgtgggaaggcgctttgtgattttggagcaagcatcaatctaatgcctaaataaattttcaat |
13840783 |
T |
|
| Q |
185 |
caattgggaattggtcaagccaaggcgactgctgtgaatctacaactggctgctaggtgtctagttcacc |
254 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| ||||||| |||| | || ||||| ||| ||||||| |
|
|
| T |
13840784 |
caattgggaattggtcaagccaagcctagtgctgcgaatctaaaacttgttgataggtctcttgttcacc |
13840853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University