View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15970_low_15 (Length: 270)
Name: NF15970_low_15
Description: NF15970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15970_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 22 - 257
Target Start/End: Original strand, 47280102 - 47280337
Alignment:
| Q |
22 |
atagctatctgtctaaaacattcacttgaggggaaataatttgtctggatatccttgctgttttgcaagtgatcaaaccatatggacattggcattcccc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47280102 |
atagctatctgtctaaaacattcacttgaggggaaataatttgtctggatatccttgctgttttgcaagtgatcaaaccatatggacattggcgttcccc |
47280201 |
T |
|
| Q |
122 |
gaagtatattctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggtgaaaaggatctga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47280202 |
gaagtatattctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggtgaaaaggatctga |
47280301 |
T |
|
| Q |
222 |
tagtattattgtgaaaatgtccagaactatccattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47280302 |
tagtattattgtgaaaatgtccagaactatccattc |
47280337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 74 - 152
Target Start/End: Original strand, 49059873 - 49059951
Alignment:
| Q |
74 |
ccttgctgttttgcaagtgatcaaaccatatggacattggcattccccgaagtatattctgattatcgggagttatggc |
152 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
49059873 |
ccttgctgttttgcaagtgatcaaaccctatggacattggcattccctgaagaatattctgattaacgggagttatggc |
49059951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 158 - 257
Target Start/End: Original strand, 49060037 - 49060136
Alignment:
| Q |
158 |
tgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggtgaaaaggatctgatagtattattgtgaaaatgtccagaactatccattc |
257 |
Q |
| |
|
|||||||| |||| || |||||||||||||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||| | |||||| |
|
|
| T |
49060037 |
tgcccgttaagactagttggagtgttcagattaccaattatcccactaggtgaaaaggatctgaaagcattattgtgaaaatgtccagaaccacccattc |
49060136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 71
Target Start/End: Original strand, 16515448 - 16515487
Alignment:
| Q |
32 |
gtctaaaacattcacttgaggggaaataatttgtctggat |
71 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16515448 |
gtctaaaacattcacttgaagggaaataatttgtctggat |
16515487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University