View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15970_low_17 (Length: 254)
Name: NF15970_low_17
Description: NF15970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15970_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 35 - 235
Target Start/End: Complemental strand, 3115621 - 3115420
Alignment:
| Q |
35 |
taagatgttgcatactcatacataataatattaatactagtaccatagtccacttcggtactagacacaacnnnnnnnngttttgtttg-aaacaacaac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
3115621 |
taagatgttgcatactcatacataataatattaatactagtaccatagtccacttcagtaatagacacaacaacttttttttttttttttaaacaacaac |
3115522 |
T |
|
| Q |
134 |
aactgttaccatatatttatgactaatgcatgcacttcatttaacaataggcactgcacttctttttgcaatcaatggtacagccaccaccaccgccgcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115521 |
aactgttaccatatatttatgactaatgcatgcacttcatttaacaataggcactgcacttctttttgcaatcaatggtacagccaccaccaccgccgcc |
3115422 |
T |
|
| Q |
234 |
ac |
235 |
Q |
| |
|
|| |
|
|
| T |
3115421 |
ac |
3115420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 35891440 - 35891482
Alignment:
| Q |
193 |
ttctttttgcaatcaatggtacagccaccaccaccgccgccac |
235 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
35891440 |
ttctttttgcaatcaatggtgcagccaccacctccaccgccac |
35891482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University