View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15971_high_12 (Length: 231)
Name: NF15971_high_12
Description: NF15971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15971_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 45510310 - 45510099
Alignment:
| Q |
1 |
tagttaagtggttcctttcaagggaggtgattgtggaatatgttggactttgagctcgttgaaaactttggaggatagggacgtgtcagtgaacggttct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45510310 |
tagttaagtggttcctttcaagggtggtgattgtggaatatgttggactttgagctcgttgaaaactttggaggatagggacgtgtcagtaaacggttct |
45510211 |
T |
|
| Q |
101 |
aaagtaacacaagcaccactcttttttgagagagcacaagcaccgctcttaaaattcgtaaatatgttaatactggtctaatagtctttagggataaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||| || |||||||||||| |
|
|
| T |
45510210 |
aaagtaacacaagcaccactcttttttgagagagcacaagcaccactcttaaaattcgtaaatatgttaatattggcctaatagactatagggataaata |
45510111 |
T |
|
| Q |
201 |
tgtttttggtcc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45510110 |
tgtttttggtcc |
45510099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University