View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15973_high_11 (Length: 238)

Name: NF15973_high_11
Description: NF15973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15973_high_11
NF15973_high_11
[»] chr3 (1 HSPs)
chr3 (19-227)||(43702344-43702549)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 43702549 - 43702344
Alignment:
19 ggaattacatgatgcggttgcaacacagaattcagattccccaacgaatcctggccgttaattaatccaacggtcttaacttgattatttggagattgtt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
43702549 ggaattacatgatgcggttgcaacacagaattcagattccccaacgaatcgtggccgttaattaatccaacggtcttaacttgattatttggagattgtt 43702450  T
119 ttagttaactcaattatttgaagatttnnnnnnnnnnnnnttggagattgagattttaggttttgttagttagtcatgtttgtctaccatgttgaatgca 218  Q
    |||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
43702449 ttagttaactcaattatttgaagattt---aaaaaaaaaattggagattgagattttaggttttgttagttagtcatgtttgtctatgatgttgaatgca 43702353  T
219 atccatatt 227  Q
    |||||||||    
43702352 atccatatt 43702344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University