View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15973_high_11 (Length: 238)
Name: NF15973_high_11
Description: NF15973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15973_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 43702549 - 43702344
Alignment:
| Q |
19 |
ggaattacatgatgcggttgcaacacagaattcagattccccaacgaatcctggccgttaattaatccaacggtcttaacttgattatttggagattgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702549 |
ggaattacatgatgcggttgcaacacagaattcagattccccaacgaatcgtggccgttaattaatccaacggtcttaacttgattatttggagattgtt |
43702450 |
T |
 |
| Q |
119 |
ttagttaactcaattatttgaagatttnnnnnnnnnnnnnttggagattgagattttaggttttgttagttagtcatgtttgtctaccatgttgaatgca |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43702449 |
ttagttaactcaattatttgaagattt---aaaaaaaaaattggagattgagattttaggttttgttagttagtcatgtttgtctatgatgttgaatgca |
43702353 |
T |
 |
| Q |
219 |
atccatatt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
43702352 |
atccatatt |
43702344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University