View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15973_low_10 (Length: 302)
Name: NF15973_low_10
Description: NF15973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15973_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 15419375 - 15419649
Alignment:
| Q |
18 |
agtaagcatctggattccttggttcgatgttgtgttttcgacaaaatggtacccataactgcaaacatagataagttggttgtgtattatcatgaatcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
15419375 |
agtaagcatctggattccttggttcgatattgtgttttcgacaaaatggtacccataactgcaaacatggattagttggttgtgtattatcatgaatcta |
15419474 |
T |
 |
| Q |
118 |
aacagactaaaacatgctacattgaacaaaatgcttatatgtgaaacatgttccttattaaagaatataaacaaacctcggcaaatttcacagcttcagc |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419475 |
aacagactaaaacatgctaaattgaacaaaatgcttatatgtgaaacatgttccttattaaagaatataaacaaacctcggcaaatttcacagcttcagc |
15419574 |
T |
 |
| Q |
218 |
catggcttcaaaagtgagaatggcaccaccatcatctgaaatatagcatgagaccttttcaatagaataatctac |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15419575 |
catggcttcaaaagtgagaatggcaccaccatcatctgaaatatagcatgagaccttttcaataggataatctac |
15419649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University