View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15973_low_16 (Length: 224)
Name: NF15973_low_16
Description: NF15973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15973_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 45196054 - 45196259
Alignment:
| Q |
13 |
agataattctctgtagttgttagattcattcaacacttgatctgtttccggaggattcaagccatgtagtgtgcgttgagctgcggcccattgtgcttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45196054 |
agataattctctgtagttgttagattcattcaacacttgatctgtttccggaggattcaagccatgtagtgtgcgttgagctgcggcccattgtgcttct |
45196153 |
T |
 |
| Q |
113 |
ctctctccttttccataatccttctttgaggtgaaggcagtctg----------catagtacnnnnnnncatggtcagatagaaacacaaattagaaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45196154 |
ctctctccttttccataatccttctttgaggtgaaggcagtctgcattacattacatagtacaaaaaaacatggtcagatagaaacacaaattagaaatt |
45196253 |
T |
 |
| Q |
203 |
aatcat |
208 |
Q |
| |
|
|||||| |
|
|
| T |
45196254 |
aatcat |
45196259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 98 - 156
Target Start/End: Original strand, 1495396 - 1495454
Alignment:
| Q |
98 |
gcccattgtgcttctctctctccttttccataatccttctttgaggtgaaggcagtctg |
156 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| || ||||||| |||||||||||||| |
|
|
| T |
1495396 |
gcccattgtgcttccctctcttcttttccatagtctttctttgtagtgaaggcagtctg |
1495454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University