View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15974_low_12 (Length: 354)
Name: NF15974_low_12
Description: NF15974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15974_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 300
Target Start/End: Complemental strand, 35939987 - 35939694
Alignment:
| Q |
15 |
aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaaccct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35939987 |
aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccagccct |
35939888 |
T |
|
| Q |
115 |
tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaacaggcagagattcttgcggcaaatgcttgagtgtatgtccactttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35939887 |
tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaacaggcagagattcttgcggcaaatgcttgactgtatgtccactttt |
35939788 |
T |
|
| Q |
215 |
ctcattttagnnnnnnntattttaaaatacaaaccattttatactc--------atttataaggttaattaagttgttaccactaaactcacat |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939787 |
ctcattttagaaaaaaatattttaaaatacaaaccattttatactcatttataaatttataaggttaattaagttgttaccactaaactcacat |
35939694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 35953597 - 35953388
Alignment:
| Q |
15 |
aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaaccct |
114 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
35953597 |
aacgttagggcaacataccacctttacaaccctcagaatattaactggaactacaacactgccagtgtttactgtgctacatgggatgccaaccagccct |
35953498 |
T |
|
| Q |
115 |
tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaaca-ggcagagattcttgcggcaaatgcttgagtgtatgtccacttt |
213 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||| | ||||| || |||||||| ||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
35953497 |
tgtcatggcgtcaaaagtatggctggactgccttttgtggacc-ccagggccctcatggcagagactcttgcggcaagtgcttgagggtatgaccacttt |
35953399 |
T |
|
| Q |
214 |
tctcattttag |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
35953398 |
actcattttag |
35953388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 35948036 - 35947917
Alignment:
| Q |
38 |
ttacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaacccttgtcatggcgtagcaaatatggt |
137 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||| ||||| |||||| |||||||| || |||||| |
|
|
| T |
35948036 |
ttacaaccctcagaatattaattgggattacaacagagccagtgtatactgtgctacctgggatgcaaaccagcccttggaatggcgtaaaaagtatggt |
35947937 |
T |
|
| Q |
138 |
tggactgccttttgtggacc |
157 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35947936 |
tggactgccttttgtggacc |
35947917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 96 - 157
Target Start/End: Complemental strand, 35929180 - 35929119
Alignment:
| Q |
96 |
tgggatgccaaccaacccttgtcatggcgtagcaaatatggttggactgccttttgtggacc |
157 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35929180 |
tgggatgcagaccagcccttgtcatggcgtagcaaatatggttggactgccttctgtggacc |
35929119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 31175148 - 31175100
Alignment:
| Q |
109 |
aacccttgtcatggcgtagcaaatatggttggactgccttttgtggacc |
157 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
31175148 |
aaccattgtcatggcgaagcaaatatggttgggctgccttttgtggacc |
31175100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 31206480 - 31206440
Alignment:
| Q |
114 |
ttgtcatggcgtagcaaatatggttggactgccttttgtgg |
154 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
31206480 |
ttgtcatggcgaagcaaatatggttgggctgccttttgtgg |
31206440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 47583367 - 47583404
Alignment:
| Q |
117 |
tcatggcgtagcaaatatggttggactgccttttgtgg |
154 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
47583367 |
tcatggcgtagcaagtatggttggactgctttttgtgg |
47583404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University